Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: Two vector control cell lines (VC1 and VC2) and two UGDH-overexpressing lines (OE1 and OE2) were selected in the LNCaP AD background. Equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing DMSO (vehicle, 0 nM) or the indicated concentration of DHT. After an additional 48 hours, cells were harvested for analysis. AR-dependent genes PSA ( A ) and UGT2B17 ( B ) were analyzed by WB in whole cell lysates; ( C ) functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates; ( D ) UDP-sugar pools were measured in cell lysates by LC-MS. In panels A–C, mean ± SEM is plotted for triplicate measurements. In panel D, mean ± SD is plotted for quadruplicate measurements. Statistical significance is indicated as: (a) p < 0.05 relative to VC1 at 0 nM DHT. (b) p < 0.05 relative to VC2 at 0 nM DHT. (c) p < 0.05 comparing OE1 to both VC1 and VC2 at the indicated [DHT]. (d) p < 0.05 comparing OE2 to both VC1 and VC2 at the indicated [DHT].

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Concentration Assay, Functional Assay, Expressing, Liquid Chromatography with Mass Spectroscopy

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: Two vector control cell lines (VC1 and VC2) and two UGDH-overexpressing lines (OE1 and OE2) were selected in the LNCaP CR background. Equal cell numbers were seeded 48 hours in androgen replete media followed by harvest of cells for analysis of gene expression ( A and B ) and UDP-sugars ( D ). For panel ( C ), equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing DMSO (vehicle, 0 nM) or the indicated concentration of DHT. After an additional 48 hours, cells and media were harvested for analysis. AR-dependent genes UGT2B17 (A) and FoxA1 (B) were analyzed by WB in whole cell lysates; (C) functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates; (D) UDP-sugar pools were measured in cell lysates by mass spectrometry. Mean ± SEM is plotted for triplicate technical measurements; * p < 0.05 for OE1 and OE2 relative to VC1 and VC2.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Expressing, Concentration Assay, Functional Assay, Mass Spectrometry

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: LNCaP AD and CR cells were selected for stable expression of a non-targeting vector control (VC1 and VC2) or a UGDH shRNA knockdown construct (KD1 and KD2). Equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing 10 nM DHT or DMSO (vehicle, 0 nM). After an additional 48 hours, cells were harvested for analysis by western blot and mass spectrometry. ( A ) AR-dependent genes PSA (panels a and d ) and UGT2B17 (panels b and e ) were analyzed by WB in whole cell lysates; functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates (panels c and f ). Panels (a–c) depict expression data in the AD background and panels (d–f) illustrate data from the CR background. Mean ± SEM is plotted. Statistical significance is indicated on the plots as: (a) p < 0.05 for that clone, comparing 0 vs 10 nM DHT; (b) p < 0.05 relative to VC1 and VC2, 10 nM DHT; (c) p < 0.05 relative to VC1 and VC2, 0 nM DHT. ( B ) UDP-sugar pools were measured in cell lysates by LC-MS for both the AD (upper) and CR (lower) backgrounds as indicated. Mean ± SD is plotted. Statistical significance is indicated as: (a) p < 0.05 for both KD1 and KD2 relative to VC1 or VC2, 0 nM DHT. (b) p < 0.05 for both KD1 and KD2 relative to VC1 or VC2, 10 nM DHT. (c) p < 0.05 for that clone, comparing 0 and 10 nM DHT.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Expressing, Plasmid Preparation, shRNA, Construct, Western Blot, Mass Spectrometry, Functional Assay, Liquid Chromatography with Mass Spectroscopy

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: ( A and B ) LNCaP AD cells overexpressing UGDH (B) were compared to vector control (A) and to LNCaP CR cells with UGDH knocked down ( C , Control; D , UGDH KD). Equal cell numbers were plated and treated for three days with the indicated concentrations of enzalutamide (in mM). Proliferating cells were quantified in a fluorescence plate reader using resazurin-resorufin conversion. Daily cell count was determined from a standard curve and represents the mean of four technical replicates ± SEM; * p < 0.05.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Fluorescence, Cell Counting

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of LV-BTF3-shRNA on BTF3 expression in Saos-2 cells. (A) BTF3 mRNA expression was found in Saos-2, U-2OS, MG-63 and HOS cells detected by PCR. (B) LV-BTF3-shRNA labelled with enhanced GFP was successfully transfected into Saos-2 cells (×200). (C) LV-BTF3-shRNA silenced the transcription of BTF3 mRNA in Saos-2 cells. Data are presented as the mean ± SEM of 3 independent experiments performed in triplicate. ** P < 0.01, LV-BTF3-shRNA vs N-shRNA.

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: shRNA, Expressing, Transfection

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of BTF3 silencing on Saos-2 cell proliferation. Cell proliferation of control, N-shRNA and LV-BTF3-shRNA treated cells was evaluated using MTT assays. Data are presented as the mean ± SEM of 3 independent experiments performed in triplicate. ** P < 0.01 control and N-shRNA vs LV-BTF3-shRNA.

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: Control, shRNA

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of BTF3 silencing on apoptosis of Saos-2 cells. Apoptosis in control, N-shRNA and LV-BTF3-shRNA treated cells was measured using an annexin-V single staining assay. (A) Representative flow cytometry images; (B) Graph of quantitative apoptosis rate analyses. Data are presented as the mean ± SEM of 3 independent experiments performed in triplicates. ** P < 0.01 vs N-shRNA.

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: Control, shRNA, Staining, Flow Cytometry

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of BTF3 silencing on the cell cycle of Saos-2 cells. The cell cycle in control, N-shRNA and LV-BTF3-shRNA treated cells was assessed using the PI single staining assay. (A) Representative flow cytometry images; (B) Quantitative cell cycle status analyses. Data are presented as the mean ± SEM of 3 independent experiments performed in triplicate. ** P < 0.01 N-shRNA vs LV-BTF3-ShRNA.

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: Control, shRNA, Staining, Flow Cytometry

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of BTF3 knockdown on colony formation of Saos-2 cells. Colony formation in control, N-shRNA and LV-BTF3-shRNA treated cells was measured using the crystal purple stain. (A) Representative images of cell colony formations; (B) Quantitative analyses of colony numbers. Data are presented as the mean ± SEM of 3 independent experiments performed in triplicate. ** P < 0.01 N-shRNA vs LV-BTF3-ShRNA.

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: Knockdown, Control, shRNA, Staining

Journal: Journal of Cancer

Article Title: BTF3 Silencing Inhibits the Proliferation of Osteosarcoma Cells

doi: 10.7150/jca.28476

Figure Lengend Snippet: Effect of shBTF3 on intracellular signalling in Saos-2 cells. (A) Modifications to STAT3 (Tyr705), RPS6 (Ser235/236), HSP27 (Ser78) and SAPK/JNK (Thr183/Tyr185) phosphorylation were observed in shBTF3-treated cells. (B) Wesetrn blot analyses of STAT3, RPS6, SAPK/JNK1 and SAPK/JNK2 expression in Saos-2 cells transfected with N-shRNA or LV-BTF3-shRNA. The right panel indicates the relative protein expressions of 3 independent measurements. * P < 0.05; ** P < 0.01

Article Snippet: Once Saos-2 cells reached a density of 50-80%, they were infected with lentivirus-BTF3-shRNA (LV-BTF3-shRNA) (sense: GCCGAAGAAGCCTGGGAATCA, antisense: TGATTCCCAGGCTTCTTCGGC) or lentivirus negative control shRNA (N-shRNA) (sense: TTCTCCGAACGTGTCACGT, antisense: ACGTGACACGTTCGGAGAA) sourced from Genechem (Shanghai, China), in antibiotic-free and serum-free Opti-MEM culture medium.

Techniques: Phospho-proteomics, Expressing, Transfection, shRNA

Journal: BMC Cancer

Article Title: Interaction between DNMT3B and MYH11 via hypermethylation regulates gastric cancer progression

doi: 10.1186/s12885-021-08653-3

Figure Lengend Snippet: Primer used for RT-qPCR

Article Snippet: The overexpressed (oe) DNA plasmids oe-MYH11, oe-TNFRSF14, oe-DNMT3B and control oe-negative control (NC) used for cell transfection were from VectorBuilder (Guangzhou, Guangdong, China).

Techniques:

Journal: BMC Cancer

Article Title: Interaction between DNMT3B and MYH11 via hypermethylation regulates gastric cancer progression

doi: 10.1186/s12885-021-08653-3

Figure Lengend Snippet: DNMT3B upregulation is responsible for the hypermethylation of the MYH11 promoter. A , the expression of DNMT3A and DNMT3B in GC was queried in StarBase Pan-cancer platform; B , the enrichment ability of DNMT3A and DNMT3B on MYH11 promoter examined by ChIP-qPCR; C , DNMT3B mRNA expression in GC tumor tissues and their adjacent tissues by RT-qPCR; D , correlation of DNMT3B expression with MYH11 promoter methylation levels in tumor tissues analyzed by Pearson’s correlation analysis (r = 0.623, p < 0.001); E , correlation of DNMT3B expression with MYH11 expression in tumor tissues (r = − 0.609, p < 0.001); F , transfection efficiency of oe-DNMT3B in GC cells by RT-qPCR; G , the effects of DNMT3B overexpression on the methylation level of MYH11 promoter examined by qMSP; H , effects of DNMT3B overexpression on MYH11 expression by RT-qPCR. Each assay was performed at least three times. Statistical significance was analyzed by paired t test (panel C) or two-way ANOVA (panels B, F, G and H) and Tukey’s multiple range tests

Article Snippet: The overexpressed (oe) DNA plasmids oe-MYH11, oe-TNFRSF14, oe-DNMT3B and control oe-negative control (NC) used for cell transfection were from VectorBuilder (Guangzhou, Guangdong, China).

Techniques: Expressing, Quantitative RT-PCR, Methylation, Transfection, Over Expression

Journal: BMC Cancer

Article Title: Interaction between DNMT3B and MYH11 via hypermethylation regulates gastric cancer progression

doi: 10.1186/s12885-021-08653-3

Figure Lengend Snippet: Mechanism diagram. Overexpression of DNMT3B in GC inhibited MYH11 expression by promoting methylation of the MYH11 promoter, thereby attenuating the repressive effect of MYH11 on TNFRSF14 transcriptional activity and promoting GC progression

Article Snippet: The overexpressed (oe) DNA plasmids oe-MYH11, oe-TNFRSF14, oe-DNMT3B and control oe-negative control (NC) used for cell transfection were from VectorBuilder (Guangzhou, Guangdong, China).

Techniques: Over Expression, Expressing, Methylation, Activity Assay